Name___________________________-
Advanced
Placement Biology
Critical
Thinking and DNA
- If
the amount of Adenine in a molecule of DNA is 20%, what is the percentage of
T, C, and G?
- If
the original strand of DNA (
template ) reads
3’
TACAAATCGCCCTACCCCCACCTCATT 5’
- Show
the complementary DNA strand
- Show
the mRNA that would be formed by the process of transcription
- Give
the sequence of the amino acids in your peptide chain.
- If
the in the fourth triplet of the DNA template the final C is changed for
the letter A, show the difference in the peptide chain.
This is what type of mutation?
- If
the letter A is inserted after the first triplet, what effect will this
have on the peptide chain. This
is what type of mutation?
- If
the final T in the last triplet is changed to a G, what effect will this
have on the polypeptide chain. This
is what type of mutation?
- Give
all the possible mRNA codons for leucine. ( Use your codon charts).
What is this phenomenon called ?
- What
anticodon matches a mRNA of 5’ CUC 3’
?
- What
is the minimum number of base substitutions that must be made to change the
codons from
- glutamic
acid to lysine?
- Leucine
to alanine?
- phenylalanine
to glycine ?