Name___________________________-

Advanced Placement Biology

Critical Thinking and DNA

 

 

  1. If the amount of Adenine in a molecule of DNA is 20%, what is the percentage of T, C, and G?

 

 

 

 

 

 

 

  1. If the original strand of  DNA ( template ) reads

 

3’ TACAAATCGCCCTACCCCCACCTCATT 5’

 

    1. Show the complementary DNA strand

 

 

 

 

    1. Show the mRNA that would be formed by the process of transcription

 

 

 

 

 

 

    1. Give the sequence of the amino acids in your peptide chain.

 

 

 

 

 

    1. If the in the fourth triplet of the DNA template the final C is changed for the letter A, show the difference in the peptide chain.  This is what type of mutation?

 

 

 

 

 

    1. If the letter A is inserted after the first triplet, what effect will this have on the peptide chain.  This is what type of mutation?

 

 

    1. If the final T in the last triplet is changed to a G, what effect will this have on the polypeptide chain.  This is what type of mutation?

 

 

 

 

  1. Give all the possible mRNA codons for leucine. ( Use your codon charts).  What is this phenomenon called ?

 

 

 

 

 

 

  1. What anticodon matches a mRNA of 5’ CUC 3’  ?

 

 

 

 

 

 

  1. What is the minimum number of base substitutions that must be made to change the codons from

 

    1. glutamic acid to lysine?

 

 

 

    1. Leucine to alanine?

 

 

 

    1. phenylalanine to glycine ?